ID: 1138590646_1138590652

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138590646 1138590652
Species Human (GRCh38) Human (GRCh38)
Location 16:57997970-57997992 16:57997992-57998014
Sequence CCCGCCAGACACTGGTGCTCATG GCGGACTGGACAGGTGCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 628} {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!