ID: 1138600228_1138600236

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1138600228 1138600236
Species Human (GRCh38) Human (GRCh38)
Location 16:58049657-58049679 16:58049678-58049700
Sequence CCAGGCACCCAGACACTGACCAT ATGGCTCCATCACTCAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 391} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!