ID: 1138607338_1138607350

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1138607338 1138607350
Species Human (GRCh38) Human (GRCh38)
Location 16:58097508-58097530 16:58097546-58097568
Sequence CCGCCCCCTGTGCTGCCGGGTTG GCAGGCTCTGACCCCAGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 22, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!