ID: 1138618046_1138618056

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1138618046 1138618056
Species Human (GRCh38) Human (GRCh38)
Location 16:58187795-58187817 16:58187828-58187850
Sequence CCCAAGATCACAGAGCCCATGGC AGGAATCAAAGCTGGAAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 349} {0: 1, 1: 0, 2: 1, 3: 29, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!