ID: 1138626367_1138626375

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1138626367 1138626375
Species Human (GRCh38) Human (GRCh38)
Location 16:58255174-58255196 16:58255191-58255213
Sequence CCCTAGAGCCCCCAGGAAGCTGC AGCTGCTGGTACAAGTCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 61, 4: 307} {0: 1, 1: 0, 2: 1, 3: 8, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!