ID: 1138633768_1138633771

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138633768 1138633771
Species Human (GRCh38) Human (GRCh38)
Location 16:58320239-58320261 16:58320261-58320283
Sequence CCATCAGTGTGATGGGATAGCTT TGTGGCTCAGTGGATAAAATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 86} {0: 1, 1: 0, 2: 0, 3: 12, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!