ID: 1138634692_1138634706

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1138634692 1138634706
Species Human (GRCh38) Human (GRCh38)
Location 16:58328376-58328398 16:58328412-58328434
Sequence CCCATTTCTCCCCATCCCCACCC TAATCTGCTTTCTGCATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 44, 3: 807, 4: 21864} {0: 1, 1: 4, 2: 33, 3: 251, 4: 919}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!