|
Left Crispr |
Right Crispr |
| Crispr ID |
1138634692 |
1138634707 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:58328376-58328398
|
16:58328427-58328449
|
| Sequence |
CCCATTTCTCCCCATCCCCACCC |
ATCTGTGGATTTGCCTATTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 44, 3: 807, 4: 21864} |
{0: 2, 1: 95, 2: 543, 3: 1448, 4: 2202} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|