ID: 1138646551_1138646554

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1138646551 1138646554
Species Human (GRCh38) Human (GRCh38)
Location 16:58429846-58429868 16:58429891-58429913
Sequence CCTCTCAAGTAGCTGGGACTACA TTGTTGTTGTTGTTGAAACAGGG
Strand - +
Off-target summary {0: 2026, 1: 49269, 2: 166609, 3: 229345, 4: 235035} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!