ID: 1138649723_1138649734

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1138649723 1138649734
Species Human (GRCh38) Human (GRCh38)
Location 16:58452835-58452857 16:58452877-58452899
Sequence CCTCAGTTTCCTAATCTGTAAAC CATCACATGGGGCTGTTATGAGG
Strand - +
Off-target summary {0: 5, 1: 111, 2: 1821, 3: 6914, 4: 15204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!