ID: 1138652164_1138652167

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1138652164 1138652167
Species Human (GRCh38) Human (GRCh38)
Location 16:58466797-58466819 16:58466823-58466845
Sequence CCCTCTCATCTTAAAGATGGAAC TGGCCCCTGTCTCTAAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 203} {0: 1, 1: 0, 2: 0, 3: 12, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!