ID: 1138654412_1138654418

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1138654412 1138654418
Species Human (GRCh38) Human (GRCh38)
Location 16:58482490-58482512 16:58482524-58482546
Sequence CCTTCATGTGTAGCACTGTCCCC CCCTTCTCACCCGTGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 110} {0: 1, 1: 0, 2: 2, 3: 14, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!