ID: 1138670463_1138670469

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1138670463 1138670469
Species Human (GRCh38) Human (GRCh38)
Location 16:58610274-58610296 16:58610316-58610338
Sequence CCAGGCATGGTGGTAGACACCTG AATCGCTTAAACGCAGGAGGTGG
Strand - +
Off-target summary {0: 15, 1: 832, 2: 12470, 3: 48626, 4: 117736} {0: 1, 1: 553, 2: 18515, 3: 63175, 4: 101954}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!