|
Left Crispr |
Right Crispr |
| Crispr ID |
1138670464 |
1138670468 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:58610293-58610315
|
16:58610313-58610335
|
| Sequence |
CCTGTAATCCCAGCTACTCAGAG |
GAGAATCGCTTAAACGCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 348, 1: 4384, 2: 66014, 3: 156492, 4: 239406} |
{0: 5, 1: 882, 2: 29355, 3: 98780, 4: 161337} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|