|
Left Crispr |
Right Crispr |
| Crispr ID |
1138670465 |
1138670469 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:58610301-58610323
|
16:58610316-58610338
|
| Sequence |
CCCAGCTACTCAGAGAATCGCTT |
AATCGCTTAAACGCAGGAGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 5, 2: 13, 3: 26, 4: 116} |
{0: 1, 1: 553, 2: 18515, 3: 63175, 4: 101954} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|