ID: 1138670465_1138670470

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1138670465 1138670470
Species Human (GRCh38) Human (GRCh38)
Location 16:58610301-58610323 16:58610319-58610341
Sequence CCCAGCTACTCAGAGAATCGCTT CGCTTAAACGCAGGAGGTGGAGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 13, 3: 26, 4: 116} {0: 1, 1: 214, 2: 8097, 3: 38252, 4: 90164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!