ID: 1138699487_1138699493

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1138699487 1138699493
Species Human (GRCh38) Human (GRCh38)
Location 16:58847005-58847027 16:58847020-58847042
Sequence CCAGCTTCGGCTCCGCATGAGAG CATGAGAGGGAGACCGTGGAGGG
Strand - +
Off-target summary {0: 125, 1: 119, 2: 538, 3: 536, 4: 285} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!