ID: 1138746502_1138746506

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1138746502 1138746506
Species Human (GRCh38) Human (GRCh38)
Location 16:59368735-59368757 16:59368775-59368797
Sequence CCGGGATGTGCTTGGCTTCTAGG CTCCTGTCATTGCACAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 11, 3: 95, 4: 393} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!