ID: 1138747211_1138747213

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138747211 1138747213
Species Human (GRCh38) Human (GRCh38)
Location 16:59377146-59377168 16:59377168-59377190
Sequence CCACTATTCAAAGTCTTCTGTTT TGTTTTAAACATATTGTCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 59, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!