ID: 1138777429_1138777434

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1138777429 1138777434
Species Human (GRCh38) Human (GRCh38)
Location 16:59740887-59740909 16:59740914-59740936
Sequence CCCACTTTCAATTTTATGCAAAT GGGAAGGTTAATGCAAATTGAGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 106, 3: 308, 4: 1063} {0: 1, 1: 9, 2: 18, 3: 44, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!