ID: 1138870225_1138870234

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1138870225 1138870234
Species Human (GRCh38) Human (GRCh38)
Location 16:60874403-60874425 16:60874442-60874464
Sequence CCTCCCGCTCAGTGTTACTTTCT TATCTCTAGCACTCACAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!