|
Left Crispr |
Right Crispr |
Crispr ID |
1138953990 |
1138953995 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:61949195-61949217
|
16:61949221-61949243
|
Sequence |
CCCTGACTCTTTGGAGTTGGGAG |
AGAAGGCAGCTGGACTTCCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 12, 1: 40, 2: 57, 3: 90, 4: 220} |
{0: 1, 1: 7, 2: 405, 3: 323, 4: 383} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|