ID: 1138979437_1138979452

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1138979437 1138979452
Species Human (GRCh38) Human (GRCh38)
Location 16:62249383-62249405 16:62249428-62249450
Sequence CCCACCCACCTCCACAATTCAGG TGTGAGGATTACAATTGGAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!