ID: 1138979445_1138979455

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1138979445 1138979455
Species Human (GRCh38) Human (GRCh38)
Location 16:62249415-62249437 16:62249441-62249463
Sequence CCCTCCCTTGACATGTGAGGATT ATTGGAGGGGAGATTTGGATGGG
Strand - +
Off-target summary {0: 17, 1: 229, 2: 1350, 3: 2783, 4: 4740} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!