ID: 1138979446_1138979453

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1138979446 1138979453
Species Human (GRCh38) Human (GRCh38)
Location 16:62249416-62249438 16:62249436-62249458
Sequence CCTCCCTTGACATGTGAGGATTA TTACAATTGGAGGGGAGATTTGG
Strand - +
Off-target summary {0: 23, 1: 415, 2: 1400, 3: 2865, 4: 4277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!