ID: 1138979447_1138979454

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1138979447 1138979454
Species Human (GRCh38) Human (GRCh38)
Location 16:62249419-62249441 16:62249440-62249462
Sequence CCCTTGACATGTGAGGATTACAA AATTGGAGGGGAGATTTGGATGG
Strand - +
Off-target summary {0: 17, 1: 162, 2: 547, 3: 1465, 4: 2576} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!