ID: 1138998865_1138998869

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1138998865 1138998869
Species Human (GRCh38) Human (GRCh38)
Location 16:62484525-62484547 16:62484573-62484595
Sequence CCCAGGTTGTCAACTATACTTTT TCTAGTAATTCCCCTTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 34, 4: 293} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!