ID: 1139006012_1139006021

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139006012 1139006021
Species Human (GRCh38) Human (GRCh38)
Location 16:62572448-62572470 16:62572496-62572518
Sequence CCGAAGGAGCCATCCTTTTCCAG CTCAGATGGGTGGACAGATTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!