ID: 1139199122_1139199126

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1139199122 1139199126
Species Human (GRCh38) Human (GRCh38)
Location 16:64954777-64954799 16:64954812-64954834
Sequence CCTTCTTGTGATCCACTCTGATC TAAGTCACTATGGCCTGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 141} {0: 1, 1: 0, 2: 1, 3: 21, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!