ID: 1139361108_1139361114

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1139361108 1139361114
Species Human (GRCh38) Human (GRCh38)
Location 16:66400835-66400857 16:66400857-66400879
Sequence CCTACCCGTGGTCATCTCAGACA AATGGGATGCCAAGTCGCACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 1, 3: 3, 4: 57}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!