ID: 1139372428_1139372437

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1139372428 1139372437
Species Human (GRCh38) Human (GRCh38)
Location 16:66477368-66477390 16:66477420-66477442
Sequence CCATGCCCAACACGACAATGGCA GAAGGCAGCTGTGCTTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 114} {0: 1, 1: 0, 2: 1, 3: 34, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!