ID: 1139373839_1139373847

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1139373839 1139373847
Species Human (GRCh38) Human (GRCh38)
Location 16:66484615-66484637 16:66484660-66484682
Sequence CCTGGGATGAGGATGTGGGTGAG CAGGAGTACCAGATGGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 49, 4: 452} {0: 1, 1: 0, 2: 1, 3: 19, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!