ID: 1139402757_1139402773

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1139402757 1139402773
Species Human (GRCh38) Human (GRCh38)
Location 16:66696024-66696046 16:66696066-66696088
Sequence CCCAGCAGCACCCAGCCCAGTAA CGAGGGCGGAGCGGACAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 253} {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!