ID: 1139405696_1139405705

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1139405696 1139405705
Species Human (GRCh38) Human (GRCh38)
Location 16:66716035-66716057 16:66716081-66716103
Sequence CCTTTTCTAGCAGAACTTTAAAT GTGAGATTTGTGGGGAGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 68, 4: 649}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!