ID: 1139408391_1139408395

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1139408391 1139408395
Species Human (GRCh38) Human (GRCh38)
Location 16:66738330-66738352 16:66738360-66738382
Sequence CCTCCACCTGCCGGGTTTAAGTA GCCTCAGCCTCCTGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 548, 3: 12082, 4: 60533} {0: 84870, 1: 190808, 2: 228673, 3: 158767, 4: 94038}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!