|
Left Crispr |
Right Crispr |
| Crispr ID |
1139408391 |
1139408399 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:66738330-66738352
|
16:66738369-66738391
|
| Sequence |
CCTCCACCTGCCGGGTTTAAGTA |
TCCTGAGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 548, 3: 12082, 4: 60533} |
{0: 53511, 1: 140483, 2: 228049, 3: 201895, 4: 144651} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|