ID: 1139415098_1139415108

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1139415098 1139415108
Species Human (GRCh38) Human (GRCh38)
Location 16:66801604-66801626 16:66801642-66801664
Sequence CCGACCAGGCTCACGTCCGTGGG GCAGCCCCGCCGCCCCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46} {0: 1, 1: 1, 2: 3, 3: 34, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!