ID: 1139430426_1139430432

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1139430426 1139430432
Species Human (GRCh38) Human (GRCh38)
Location 16:66908241-66908263 16:66908262-66908284
Sequence CCTGGTGATGGTGATGGTGCCTC TCCACCCCAGGGCAGATGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 355} {0: 1, 1: 0, 2: 2, 3: 22, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!