ID: 1139441153_1139441154

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1139441153 1139441154
Species Human (GRCh38) Human (GRCh38)
Location 16:66967937-66967959 16:66967952-66967974
Sequence CCGTGTATAGTCAGGTCTCCCTC TCTCCCTCTGTTGCCCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 105} {0: 64, 1: 3702, 2: 49999, 3: 144688, 4: 216791}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!