ID: 1139451296_1139451311

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1139451296 1139451311
Species Human (GRCh38) Human (GRCh38)
Location 16:67029610-67029632 16:67029657-67029679
Sequence CCGGGGCGGCCATCGCCCGCAGC CGCTGGGAGGGCGGGCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 131} {0: 1, 1: 0, 2: 6, 3: 69, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!