ID: 1139451346_1139451352

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1139451346 1139451352
Species Human (GRCh38) Human (GRCh38)
Location 16:67029827-67029849 16:67029847-67029869
Sequence CCCGGGGCGCGCGCGGGTCACTT CTTGTTGCGCGGGGCCGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55} {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!