ID: 1139460878_1139460889

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1139460878 1139460889
Species Human (GRCh38) Human (GRCh38)
Location 16:67121450-67121472 16:67121493-67121515
Sequence CCTCGACCTCCCAGAGTGCTGGG TGCCTGGCCAAGAGTGGGCAGGG
Strand - +
Off-target summary {0: 76, 1: 6798, 2: 133961, 3: 273261, 4: 207408} {0: 1, 1: 0, 2: 2, 3: 29, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!