ID: 1139465325_1139465337

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1139465325 1139465337
Species Human (GRCh38) Human (GRCh38)
Location 16:67151019-67151041 16:67151057-67151079
Sequence CCCAGACTTCTGGAGCTCAGCTC AGCACTCCGGCCTCAGAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 231} {0: 1, 1: 0, 2: 3, 3: 12, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!