ID: 1139484030_1139484049

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1139484030 1139484049
Species Human (GRCh38) Human (GRCh38)
Location 16:67246344-67246366 16:67246394-67246416
Sequence CCCAGAGTCCTGGCCCGGAAACA GGCTGACGGCGGCGAGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 128} {0: 1, 1: 0, 2: 1, 3: 14, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!