ID: 1139484926_1139484933

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1139484926 1139484933
Species Human (GRCh38) Human (GRCh38)
Location 16:67249996-67250018 16:67250011-67250033
Sequence CCCTCCTCCTTCTCCCTGTTGTG CTGTTGTGCTGGCTCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 696} {0: 1, 1: 0, 2: 5, 3: 112, 4: 699}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!