ID: 1139484926_1139484934

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1139484926 1139484934
Species Human (GRCh38) Human (GRCh38)
Location 16:67249996-67250018 16:67250012-67250034
Sequence CCCTCCTCCTTCTCCCTGTTGTG TGTTGTGCTGGCTCTGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 696} {0: 1, 1: 0, 2: 0, 3: 20, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!