ID: 1139489538_1139489548

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1139489538 1139489548
Species Human (GRCh38) Human (GRCh38)
Location 16:67279125-67279147 16:67279156-67279178
Sequence CCGCGGTGCCCCCCGCGCACTCA CACCCACGCGGCCTTCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 127} {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!