ID: 1139489996_1139490005

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139489996 1139490005
Species Human (GRCh38) Human (GRCh38)
Location 16:67280820-67280842 16:67280868-67280890
Sequence CCTAGAGGCGGTGGAGGTGGAGT CTTCCTCCCCACAGGGACTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 264} {0: 1, 1: 0, 2: 3, 3: 38, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!