ID: 1139490543_1139490547

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1139490543 1139490547
Species Human (GRCh38) Human (GRCh38)
Location 16:67283729-67283751 16:67283749-67283771
Sequence CCTTGGGTCTTGGGCCTGGAGCT GCTCAGAGGAGAGGTCTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 280} {0: 1, 1: 0, 2: 6, 3: 27, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!