ID: 1139496315_1139496317

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1139496315 1139496317
Species Human (GRCh38) Human (GRCh38)
Location 16:67321674-67321696 16:67321691-67321713
Sequence CCACATGCAGCGCCTCATTAGGA TTAGGATGTGTCTGAAGTCTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 8, 4: 66} {0: 1, 1: 0, 2: 9, 3: 19, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!